4913 results for "*oma"

in 31.62 milliseconds.

• Assessment of candidate high-grade serous ovarian carcinoma predisposition genes through integrated germline and tumour sequencing

  High-grade serous ovarian carcinoma (HGSOC) has a significant hereditary component, only half of which is explained. Previously, we performed germline exome sequencing on BRCA1 and BRCA2-negative HGSOC patients, revealing three proposed and 43 novel candidate genes enriched with rare loss-of-function variants. For validation, we undertook case-control analyses using genomic data from disease-free controls. This confirms enrichment for nearly all previously identified genes. Additionally, one-hundred-and-eleven HGSOC tumours from variant carriers were sequenced alongside other complementary studies, seeking evidence of biallelic inactivation as supportive evidence. PALB2 and ATM validate as HGSOC predisposition genes, with 6/8 germline carrier tumours exhibiting biallelic inactivation accompanied by characteristic mutational signatures. Among candidate genes, only LLGL2 consistently shows biallelic inactivation and protein expression loss, supporting it as a novel HGSOC susceptibility gene. The remaining candidate genes fail to validate. Integrating case-control analyses with tumour sequencing is thus crucial for accurate gene discovery in familial cancer studies.

  Study EGAS50000000770

• Paired-end Whole Exome-seq analysis of the 3D evolution of glioma cell populations. Part 1.

  Dataset contains Exome sequencing data (aligned and base quality score recalibrated BAM files) for 236 tumor samples + matched normal from blood, collected from 21 patients with adult diffuse glioma. The majority of these samples were spatially-mapped during sample collection, enabling the genomic information derived from them to be mapped in 3D space.

  Dataset EGAD00001005221

• Paired-end RNA-seq analysis of the 3D evolution of glioma cell populations. Part 1.

  Dataset includes 160 double-stranded RNAseq libraries collected from 16 patients with adult diffuse glioma. The majority of these samples were spatially-mapped during sample collection, enabling the genomic information derived from them to be mapped in 3D space.

  Dataset EGAD00001005222

• Oesophageal adenocarcinoma scRNAseq from LUD2015-005 study (NCT02735239, EudraCT 2015-005298-19)

  This dataset contains single-cell RNA-seq generated from the LUD2015-005 study (NCT02735239, EudraCT 2015-005298-19) and additional donors with Barrett's oesophagus using the 5' Single Cell Gene Expression assay from 10x Genomics. Samples were generated from oesophageal tumours, Barrett's oesophagus, and normal oesophagus and gastric tissues, with the aim of generating a reference atlas for cell types found in normal and disease-associated tissue states in the upper GI tract. This reference atlas was used as the basis for a deconvolution workflow to estimate the cell composition of bulk transcriptomes from these tissues, and to assess cell type-specific expression patterns of potential predictive biomarkers for immunochemotherapy regimens in this setting.

  Dataset EGAD00001009401

• Molecular biomarkers for stratification periheral T cell lymphoma

  Peripheral T cell lymphoma (PTCL) is a diverse group of rare lymphoid malignancies with overall poor prognosis. Diverse biological mchanisms behind these diverse disease groups make targeted treatment challenging. Based on molecular biomarkers, more , the aim is to characterise more specific features for the different clinically defined PTCL for new future prognostic therapies.

  Study EGAS00001006691

• nEODURVARIB clinical trial. Exome sequencing in advanced urothelial carcinoma

  Exome sequencing (BAM and VCF files) in advanced urothelial carcinoma in diagnostic and pos-ttreatment samples

  Dataset EGAD50000001162

• Melanoma Genome Sequencing Project

  Melanoma is the most prevalent cause of skin cancer morbidity and mortality. In order to characterize the full range of somatic mutations that may drive the growth of melanoma, we are sequencing tumor and normal DNA from a set of roughly 150 melanomas. For the majority of samples (approximately 90% of the cases), mutations in protein coding genes will be assessed in the exonic DNA of tumor-normal pairs using hybrid capture and paired-end DNA sequencing. For a few of DNA samples (approximately 10% of the cases), the entire genomes will be analyzed to assess the possible contribution of complex structural rearrangements contributing to oncogenesis. The sequencing data are supplemented by copy number profiling on the same tumors using high-density SNP arrays. Integration of these approaches will enable the unbiased and comprehensive characterization of both known and novel recurrent DNA alterations that arise in melanoma.Versions 1-4 contain whole exome and bulk RNA sequencing data for patients with melanoma.Version 5 - We compared somatic genomic profiles from matched pre-treatment and post-resistance tumor biopsies in patients with metastatic melanoma who exhibited heterogeneous responses to immune checkpoint inhibitors (ICIs). This version includes whole exome sequencing (WES) data from 14 patients.

  Study phs000452

• Genomic and transcriptome analysis for intrahepatic cholangiocarcinoma

  Study EGAS00001006007

• Malignant mesothelioma EWAS on European prospective study

  Study EGAS00001006432

• Hepatocellular carcinoma xenografts established from needle biopsies preserve the characteristics of the originating tumors

  Study EGAS00001003396

• Sclerosing Epithelioid Fibrosarcoma sequencing data

  Study EGAS00001007370

• Multi Omics of glioma in the the Chinese Glioma Genome Atlas (CGGA) project

  Study EGAS00001004729

• TULIPs decorate the three-dimensional genome of PFA ependymoma

  Study EGAS00001005476

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• A genome-wide association study for nasopharyngeal carcinoma in Hong Kong population

  Study EGAS00001006102

• ID1 in glioblastoma

  Study EGAS00001003711

• Polyomavirus-positive Merkel cell carcinoma derived from a trichoblastoma suggests an epithelial origin of Merkel cell carcinoma

  Study EGAS00001003784

• Targetable ERBB2 Mutations in Neurofibroma/Schwannoma Hybrid Nerve Sheath Tumors

  Study EGAS00001003776

• Molecular profiling reclassifies adult astroblastoma into known and clinically distinct tumor entities with frequent MAPK pathway alterations

  Study EGAS00001003798

• Small molecule screen reveals synergy of cell cycle checkpoint kinase inhibitors with DNA-damaging chemotherapies in medulloblastoma (RNAseq dataset)

  Study EGAS00001004748

• WGS of Roma (Romani/Rroma) and European/Romanian individuals from Romania

  Study EGAS00001003624

• The whole genome landscape of Burkitt lymphoma subtypes

  Study EGAS00001003778

• Multiregion Whole-Exome Sequencing Uncovers the Genetic Evolution and Mutational Heterogeneity of Early-Stage Metastatic Melanoma.

  Study EGAS00001004320

• Accelerated single cell seeding in relapsed multiple myeloma

  Study EGAS00001004404

• Impact of genetic variants in clinical outcome of a cohort of patients with oropharyngeal squamous cell carcinoma

  Study EGAS00001004430

• Circulating tumor cells for comprehensive and multiregional non-invasive genetic characterization of multiple myeloma

  Study EGAS00001004288

• Genomic characterization of retinoblastoma

  Study EGAS00001005248

• Multiscale heterogeneity in gastric adenocarcinoma evolution is an obstacle to precision medicine

  Study EGAS00001004525

• Deep MRD profiling defines outcome and unveils different modes of treatment resistance in standard and high risk myeloma

  Study EGAS00001004558

• Selective Elimination of Immunosuppressive T cells in Patients with Multiple Myeloma

  Study EGAS00001004915

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• AUBTRG - Whole Exome Sequencing of Diffuse Glioma Samples

  Study EGAS00001003035

• Integrated Genomic and Transcriptomic Analysis Reveals Unique Characteristics of Hepatic Metastases and Pro-metastatic Role of Complement C1q in Pancreatic Ductal Adenocarcinoma

  Study EGAS00001004821

• Genomic Analysis of Focal Nodular Hyperplasia with Associated Hepatocellular Carcinoma Unveils its Malignant Potential

  Study EGAS00001005313

• Immune infiltrate and tumor microenvironment transcriptional programs stratify pediatric osteosarcoma into prognostic groups at diagnosis

  Study EGAS00001005326

• WGS Leiomyosarcoma subtypes

  Study EGAS00001005341

• RNA-seq on neuroblastoma PDX model COG-N-519 treated with control miR-1283 and test miR-99b-5p mimics

  Study EGAS00001005368

• Epigenetic encoding, heritability and plasticity of glioma transcriptional cell states

  Study EGAS00001005472

• Single-cell characterization of anti-LAG3+anti-PD1 treatment in melanoma patients

  Study EGAS00001005580

• Berlin Neuroblastoma Dataset Update 2021

  Study EGAS00001005604

• PIK3CA mutation in a case of CTNNB1 mutant sinonasal glomangiopericytoma

  Study EGAS00001005653

• Myeloma methylation

  Study EGAS00001005788

• Mutations in ALK signaling pathways conferring resistance to ALK inhibitor treatment lead to collateral vulnerabilities in neuroblastoma cells

  Study EGAS00001005791

• RNA-seq data from 27 glioblastoma samples

  Study EGAS00001005807

• Orthotopic murine Group 3 medulloblastoma in C57Bl/6 mice treated with saline, cyclophosphamide or gemcitabine

  Study EGAS00001005846

• Orthotopic murine Group 3 medulloblastoma in C57Bl/6 mice treated with sham or craniospinal irradiation

  Study EGAS00001005847

• Overexpression of the miR-17-92 cluster in colorectal adenoma organoids induces a carcinoma-like genotype

  Study EGAS00001005949

• Oesophageal adenocarcinoma whole exome and RNA-seq raw sequencing data

  Study EGAS00001005957

• Targeted analysis of cell-free circulating tumor DNA is suitable for early relapse and actionable target detection in patients with neuroblastoma

  Study EGAS00001006027

• A multi-center genome-wide association study for nasopharyngeal carcinoma

  Study EGAS00001006062

• Molecular characterization of a renal cell carcinoma PDX cohort

  Study EGAS00001006249

• Genomic profiling of metastatic basal cell carcinoma reveals candidate drivers of disease and therapeutic targets

  Study EGAS00001006148

• Validation of a targeted sequencing panel for multiple myeloma

  Study EGAS00001006164

• Study of the microenvironment of angioimmunoblastic T-cell lymphoma

  Study EGAS00001006401

• A Risk Score Incorporating Low Pass Whole Genome Sequencing of Cell Free DNA from Patients Receiving CD19 CAR T-Cell Therapy for Large B-Cell Lymphoma

  Study EGAS00001006308

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  Study EGAS00001006342

• Soft tissue sarcoma sequencing data

  Study EGAS00001006356

• Single-cell study of 14 childhood medulloblastoma patients

  Study EGAS00001006392

• Quantitative Exploratory Proteomics Analysis of Glioblastoma in Initial and Recurrent Tumors

  Study EGAS00001006395

• Case Report: early contribution of germline and nevi genetic alterations to a rapidly-progressing Cutaneous Melanoma Patient

  Study EGAS00001006459

• microRNA and isomiR profiling of Stage 1 epithelial ovarian carcinoma

  Study EGAS00001006617

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - WGS

  Study EGAS00001006843

• Genomic Analysis of a Metastatic Fusion-negative Embryonal Rhabdomyosarcoma

  Study EGAS00001006946

• Germline variants in childhood cutaneous melanoma

  Study EGAS00001006995

• Whole genome, RNA-seq and single-cell Multiome profile of multiple myeloma

  Study EGAS00001007014

• VRK3 depletion in Pontine Diffuse Midline Glioma (DMG)-K27 altered cells

  Study EGAS00001007047

• Genomic Landscape of Follicular Lymphoma Across a Wide Spectrum of Clinical Behaviors

  Study EGAS00001007105

• TIGIT is the central player in T-cell suppression associated with CAR T-cell relapse in mantle cell lymphoma

  Study EGAS00001007113

• Exploration of neuroblastoma xenograft models for tumor extracellular RNA profiling in murine blood plasma

  Study EGAS00001007295

• Detection of somatic mutations of angioimmunoblastic T-cell lymphoma

  Study EGAS00001007333

• Integrative genomic analyses of European intrahepatic cholangiocarcinoma: new ROS1 fusion gene and PBX1 as prognostic marker

  Study EGAS00001007525

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. Paired tumor and non-tumor WGS was performed to evaluate the presence of IgH-associated translocations and hyperdiploidy events, initially detected by FISH, in a subset of samples included in this study.

  Study EGAS50000000801

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Myeloma Pathobiology Mediators and Potential Targets

  Multiple myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors and has been studied utilizing approaches focused on CD138+ cells. By combining single-cell (sc)RNA- with scB-cell receptor (BCR)-sequencing, we differentiate monoclonal/neoplastic from polyclonal/normal PCs, and find more dysregulated genes, especially in precursor patients, than by analyzing bulk PCs. To determine if this approach can identify oncogenes that contribute to disease pathobiology, MAD2L1 and MAT2A are validated as targets with drug-like molecules that suppress myeloma growth in pre-clinical models. Moreover, functional studies show a role of LAMP5, which is uniquely expressed in neoplastic PCs, in tumor progression and aggressiveness via interactions with c-MYC. Finally, a monoclonal antibody recognizing cell-surface LAMP5 shows efficacy as an antibody-drug conjugate and in a chimeric antigen receptor-guided T-cell format. These studies provide additional insights into myeloma biology and identify potential targeted therapeutic approaches that can be applied to reverse myeloma progression.

  Study EGAS50000000802

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. We identified a panel of genes that were over- or under-expressed in symptomatic states that could be putative oncogenic drivers or tumor suppressors, respectively.

  Study EGAS50000000803

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma

  Study EGAS50000000313

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146

• metastatic uveal melanoma tumour biopsies

  Tumour biopsies were obtained from uveal melanoma patients pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000864

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• A neoadjuvant, phase II trial demonstrates efficacy and tolerability of Talimogene laherparepvec in cutaneous basal cell carcinoma (NeoBCC trial)

  We present a single arm, phase II neoadjuvant trial with the oncolytic virus Talimogene laherparepvec (T-VEC) in 18 patients with difficult-to-resect basal cell carcinomas. Six cycles of T-VEC were applied intralesionally. The primary endpoint of the study, defined as the proportion of the patients, who after six cycles of T-VEC (13 weeks) at the time point of surgery, become resectable with primary wound closure without the need for plastic reconstructive surgery like skin flaps or skin grafts, was achieved (9/18 patients; 50.0%). Secondary endpoints also included the relapse free survival rate (100%), overall survival (100%) and biological read outs in the tumor samples. T-VEC led to a significant increase of cytotoxic T cells, B cells and myeloid cells, and a decrease of Tregs within the tumor microenvironment. We observed a potent induction of antitumoral and antiviral T cell clones, as well as a strong humoral immune response. The objective response rate was 55.6% and the complete pathological response rate was 33.3%. Only mild adverse events occurred. Together, neoadjuvant T-VEC represents a viable treatment option for patients with difficult-to-resect BCCs (EudraCT Number 2018-002165-19).

  Study EGAS50000000252

• Epigenetic landscape reorganization and reactivation of embryonic development genes are associated with malignancy in IDH-mutant astrocytoma

  Accurate grading of IDH-mutant gliomas is crucial for determining patient prognosis and guiding treatment decisions. However, histological grading can be challenging, so we aimed to identify objective molecular markers. To this end, we conducted bulk RNA sequencing on primary IDH-mutant astrocytomas (n=138) from the prospective CATNON trial, which evaluated the prognostic impact of adjuvant and concurrent temozolomide. Using this data, we sought to identify molecular markers linked to increased malignancy in IDH-mutant astrocytomas to establish objective grading criteria.

  Study EGAS50000000381

• Whole exome sequencing of pre-invasive lung adenocarcinoma in non-smokers

  The prevalence of lung adenocarcinoma (LUAD) has increased sharply in East Asia. Early diagnosis leads to better survival rates, but this requires an improved understanding of the molecular changes during early tumorigenesis, particularly in non-smokers. We performed whole exome-sequencing and RNA-sequencing for samples from 94 East Asian patients with precancerous lesions (25 with atypical adenomatous hyperplasia [AAH]; 69 with adenocarcinoma in situ [AIS]) and 73 patients with early invasive lesions (minimally invasive adenocarcinoma [MIA]). Cellular analysis revealed that the activities of endothelial and stromal cells could categorize tumors into molecular subtypes within pathology-defined lesion types. These subtypes were linked with the advanced radiology-defined lesion type and coordinated with immune cell infiltration throughout the progression of LUAD. Characterization of these lesion types identified positively selected mutation patterns, and suggested that angiogenesis of the late-stage AIS type potentially contributes to tissue invasion of the MIA type. Our findings offer a novel resource that may help to improve early diagnosis and patient prognosis, and also suggest possible approaches for early disease interception.

  Study EGAS50000000438

• Fragmentomic features of individuals with different cfDNA concentrations

  The goal of this study is to explore fragmentomic patterns that vary between individuals of different concentrations of total cell-free DNA in plasma. We have selected a large cohort of individuals (ethnically Chinese men with a median age of 54 years, IQR 49-57) who were part of a screening of a large-scale clinical study to screen for nasopharyngeal carcinoma. Differences in fragmentomic features provided insights into the modulation of cfDNA levels in blood circulation. Fragmentomic and machine learning systems adopted in this study have also been applied to assess the quantity of cfDNA species of clinical interest, including the fraction of circulating fetal and tumor DNA, from pregnancy cases and individuals with hepatocellular carcinoma, respectively.

  Study EGAS50000000692

• Bone marrow breakout lesions act as key sites for tumor-immune cell diversification and exhaustion in multiple myeloma

  Multiple myeloma is a disease characterized by the expansion of cancerous plasma cells in the bone marrow. The bone marrow microenvironment plays a pivotal role in supporting myeloma growth and modulating tumor immunity. As the disease progresses, myeloma cells may become independent of the bone marrow environment, leading to extramedullary disease associated with poor prognosis. However, the early processes associated with bone marrow independence and its implications for disease and immune control remain poorly understood. Here, we employed comprehensive single-cell and spatial mapping to identify the disruption of the cortical bone and subsequent expansion of myeloma cells in breakout lesions as a key event in multiple myeloma pathogenesis and tumor immunity. Breakout lesions harbor an adapted niche and a unique immune microenvironment conferred by sustained immune-tumor interactions. In particular, tumor-reactive T cells with a highly exhausted phenotype, alongside unique NK cell and macrophage subtypes, specifically expanded in breakout lesions. Spatially-resolved genomic, transcriptomic and cellular analyses uncovered extensive intra-lesion heterogeneity, suggesting a divergent co-evolution of genomic variation and locally confined T cell responses in distinct subregions. Ultra-high plex imaging revealed that tumor-reactive T cells, together with other immune-regulatory cells and dendritic cells, co-expand and exhaust upon sustained tumor interactions in locally confined immune islands. In contrast, immune-regulatory macrophage and NK cell subsets operate spatially separated within myeloma cell deserts. Jointly, our analyses uncover bone marrow breakout lesions as a hotspot for tumor-immune cell interactions, diversification and exhaustion, representing a key event in myeloma pathogenesis with significant therapeutic implications.

  Study EGAS50000000304

• WGS data of multiple myeloma

  Dataset containing WGS data from 4 patients with 17 samples with multiple myeloma. The sequencing was always paired and performed using Illumina NovaSeq 6000

  Dataset EGAD50000000437

• scRNA data of multiple myeloma

  Dataset containing 36 samples of multiple myeloma. The sequencing was always paired and performed on Illumina NextSeq 550 and Illumina NovaSeq 6000.

  Dataset EGAD50000000438

• Molecular correlates for HPV-negative head and neck cancer engraftment prognosticate patient outcomes

  Head and neck squamous cell carcinoma (HNSCC) tumors were sampled from 88 patients. Samples were implanted subcutaenously into the flank of NOD/SCID/IL2R-/- mice. Mice were then monitored weekly for tumor growth and the time of initial palpation was recorded. Mice were euthanized when tumors reached 15 mm in diameter or after 6 months. If no tumor formed by 6 months, the patient tumor was defined as Non-engrafter (N). RNA-seq was performed on all primary tumor samples and successfully engrafted patient-derived xenograft (PDX) samples.

  Study EGAS50000000714

• Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL)

  Enteropathy associated T cell lymphoma (EATL) is frequently preceded by a state of refractoriness to the gluten-free diet, called “refractory celiac disease” or RCD. We aim to study which mutations and copy number aberrations are already manifest in RCD and to identify differences between RCD patients that do, and do not, develop EATL. We have applied whole exome sequencing to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Study EGAS00001006669

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program - Neuroblastoma

  The goal of NCI's Pediatric In Vivo Testing Consortium (PIVOT) is to advance the development of effective treatments for pediatric cancers through preclinical in vivo testing of novel therapeutic agents. To design impactful experiments that can be rapidly translated to the clinic, PIVOT investigators require comprehensive genomic characterization of the patient-derived xenograft (PDX) models used across the consortium. This robust experimental design enhances collaboration with industry partners by providing proof-of-concept data for drugs in development. As part of this effort, neuroblastoma PDX models are being molecularly characterized to identify promising therapeutic candidates. The molecular profiling includes whole exome sequencing (WES), RNA-seq, MethylEPIC array, CytoSNP array, and DNA fingerprinting for quality control. Additionally, demographic and clinical data (e.g., diagnosis, disease site, disease status) are shared. These characterized PDX models, matched with patient tumors, guide model selection for preclinical drug testing.

  Study phs003163

• Genomic analysis of head and neck squamous cell carcinoma upon acquired resistance to cetuximab

  Anti-epidermal growth factor receptor (EGFR) monoclonal antibodies (cetuximab) remain the only FDA-approved targeted therapy for patients with recurrent/metastatic head and neck squamous cell carcinoma (HNSCC). Unfortunately, most patients develop acquired resistance to cetuximab and there is currently no further therapeutic option for these patients (unmet clinical need), thereby highlighting the need to better understand resistance-causing mechanisms. Here, we carried out whole-exome sequencing on 2 cetuximab-sensitive and -resistant patient-derived xenograft models of HNSCC. Our data reveal several genetic alterations (mutations and copy number variations) associated with acquired resistance to anti-EGFR therapy.

  Study EGAS50000000800

• TIGER-LC High-Throughput Sequencing

  Intrahepatic cholangiocarcinoma (CCA) and hepatocellular carcinoma (HCC) are clinically disparate primary liver cancers with etiological and biological heterogeneity. We performed sequencing on multiple data levels of Thai CCA and HCC among the Thailand Initiative in Genomics and Expression Research for Liver Cancer (TIGER-LC) cohort using targeted OncoVar platform, whole exome, whole transcriptome, and whole genome metagenomic sequencing.

  Study phs001199

• A Clone's Genomic Stability as a Biomarker of Its DNA-Damage Resilience

  A main problem in the treatment of advanced cancers, including gastric cancers and glioblastoma, is the incertitude at which we predict how individual patients will respond to DNA-damaging agents, especially on the long run. Knowing the mechanism behind a patient's response, or the lack thereof, will help us depart from the oversimplified “more-is-better” and “one-size-fits-all” principles according to which DNA-damaging agents are administered. This will improve clinical outcome by allowing us to pinpoint those who would respond better and longer to lower doses than to higher doses of DNA-damaging agents. Under the assumption that the success of DNA-damaging therapy increases with the proliferation rate of a relatively homogeneous tumor population, there was little reason to assume anything other than monotonic dose-response relations. With the recent paradigm shift that most cancers are in fact DNA mosaic products of ongoing evolution, comes the urgency to reconsider these fundamental principles behind DNA-damaging therapy administration. As the developers of one of the first DNA deconvolution methods and with access to technologies to profile the transcriptomes of up to 10,000 cells simultaneously, we are equipped to embark on first personalized dose-finding strategies for DNA-damaging therapies. We will test the potential of the very long-term legacy that DNA-damage entails on a cell “genomic instability” as new biomarker of DNA-damage response. Our preliminary studies showed that, for most cancer types, DNA-damaging agents change a clone's genomic instability and that clones succumb to a limit in the amount of genomic instability they can tolerate. In particular, our results showed that patients with intermediate genomic instability have a very poor outcome and that this relation is only evident among treatment-naive patients, but not among patients treated with DNA-damaging agents. Further they show that we can measure genomic instability per clone and that clones with extreme genomic instability typically don't grow large. Our hypothesis that genomic instability, rather than proliferation rate, determines how sensitive a tumor is to DNA-damaging agents on the long-term, is founded on two unexpected findings. Patients with extremely high genomic instability per tumor clone have an exceptionally good outcome. Aim 1 will integrate exome- and single cell RNA-Seq (scRNA-Seq) data to characterize clones and to measure how much genomic instability they can tolerate. Low genomic instability is associated with reduced benefit from DNA-damaging agents. Aim 2 will use comet assays and treatment history to quantify DNA damage per clone, relating it to the clones' ability to tolerate DNA damage and to changes in the genomic instability of therapy-surviving clones.

  Study phs003762

• Assessing Individual Head and Neck Squamous Cell Carcinoma Patient Response to Therapy Through Integration of Functional and Genomic Data

  This study combines RNA sequencing (RNASeq), whole exome sequencing (WES), reverse phase protein array (RPPA) and copy number variation (CNV) data, along with a custom high throughput inhibitor assay to characterize tumor cells from patients with head and neck squamous cell carcinoma (HNSCC), in order to identify potential therapy targets on an individual patient basis. The data that will be available through dbGaP include the RNASeq, WES, RPPA and array CNV data for the tumor and matched normal samples. This study represents a proof-of-concept. No treatments were administered to patients as part of this study.

  Study phs003456