4774 results for "*oma"

in 50.19 milliseconds.

• Berlin Neuroblastoma Dataset Update 2021

  Study EGAS00001005604

• PIK3CA mutation in a case of CTNNB1 mutant sinonasal glomangiopericytoma

  Study EGAS00001005653

• Myeloma methylation

  Study EGAS00001005788

• Mutations in ALK signaling pathways conferring resistance to ALK inhibitor treatment lead to collateral vulnerabilities in neuroblastoma cells

  Study EGAS00001005791

• RNA-seq data from 27 glioblastoma samples

  Study EGAS00001005807

• Orthotopic murine Group 3 medulloblastoma in C57Bl/6 mice treated with saline, cyclophosphamide or gemcitabine

  Study EGAS00001005846

• Orthotopic murine Group 3 medulloblastoma in C57Bl/6 mice treated with sham or craniospinal irradiation

  Study EGAS00001005847

• Overexpression of the miR-17-92 cluster in colorectal adenoma organoids induces a carcinoma-like genotype

  Study EGAS00001005949

• Oesophageal adenocarcinoma whole exome and RNA-seq raw sequencing data

  Study EGAS00001005957

• Targeted analysis of cell-free circulating tumor DNA is suitable for early relapse and actionable target detection in patients with neuroblastoma

  Study EGAS00001006027

• A multi-center genome-wide association study for nasopharyngeal carcinoma

  Study EGAS00001006062

• Molecular characterization of a renal cell carcinoma PDX cohort

  Study EGAS00001006249

• Genomic profiling of metastatic basal cell carcinoma reveals candidate drivers of disease and therapeutic targets

  Study EGAS00001006148

• Validation of a targeted sequencing panel for multiple myeloma

  Study EGAS00001006164

• Study of the microenvironment of angioimmunoblastic T-cell lymphoma

  Study EGAS00001006401

• A Risk Score Incorporating Low Pass Whole Genome Sequencing of Cell Free DNA from Patients Receiving CD19 CAR T-Cell Therapy for Large B-Cell Lymphoma

  Study EGAS00001006308

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  Study EGAS00001006342

• Soft tissue sarcoma sequencing data

  Study EGAS00001006356

• Single-cell study of 14 childhood medulloblastoma patients

  Study EGAS00001006392

• Quantitative Exploratory Proteomics Analysis of Glioblastoma in Initial and Recurrent Tumors

  Study EGAS00001006395

• Case Report: early contribution of germline and nevi genetic alterations to a rapidly-progressing Cutaneous Melanoma Patient

  Study EGAS00001006459

• microRNA and isomiR profiling of Stage 1 epithelial ovarian carcinoma

  Study EGAS00001006617

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - WGS

  Study EGAS00001006843

• Genomic Analysis of a Metastatic Fusion-negative Embryonal Rhabdomyosarcoma

  Study EGAS00001006946

• Germline variants in childhood cutaneous melanoma

  Study EGAS00001006995

• Whole genome, RNA-seq and single-cell Multiome profile of multiple myeloma

  Study EGAS00001007014

• VRK3 depletion in Pontine Diffuse Midline Glioma (DMG)-K27 altered cells

  Study EGAS00001007047

• Genomic Landscape of Follicular Lymphoma Across a Wide Spectrum of Clinical Behaviors

  Study EGAS00001007105

• TIGIT is the central player in T-cell suppression associated with CAR T-cell relapse in mantle cell lymphoma

  Study EGAS00001007113

• Exploration of neuroblastoma xenograft models for tumor extracellular RNA profiling in murine blood plasma

  Study EGAS00001007295

• Detection of somatic mutations of angioimmunoblastic T-cell lymphoma

  Study EGAS00001007333

• Integrative genomic analyses of European intrahepatic cholangiocarcinoma: new ROS1 fusion gene and PBX1 as prognostic marker

  Study EGAS00001007525

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. Paired tumor and non-tumor WGS was performed to evaluate the presence of IgH-associated translocations and hyperdiploidy events, initially detected by FISH, in a subset of samples included in this study.

  Study EGAS50000000801

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Myeloma Pathobiology Mediators and Potential Targets

  Multiple myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors and has been studied utilizing approaches focused on CD138+ cells. By combining single-cell (sc)RNA- with scB-cell receptor (BCR)-sequencing, we differentiate monoclonal/neoplastic from polyclonal/normal PCs, and find more dysregulated genes, especially in precursor patients, than by analyzing bulk PCs. To determine if this approach can identify oncogenes that contribute to disease pathobiology, MAD2L1 and MAT2A are validated as targets with drug-like molecules that suppress myeloma growth in pre-clinical models. Moreover, functional studies show a role of LAMP5, which is uniquely expressed in neoplastic PCs, in tumor progression and aggressiveness via interactions with c-MYC. Finally, a monoclonal antibody recognizing cell-surface LAMP5 shows efficacy as an antibody-drug conjugate and in a chimeric antigen receptor-guided T-cell format. These studies provide additional insights into myeloma biology and identify potential targeted therapeutic approaches that can be applied to reverse myeloma progression.

  Study EGAS50000000802

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. We identified a panel of genes that were over- or under-expressed in symptomatic states that could be putative oncogenic drivers or tumor suppressors, respectively.

  Study EGAS50000000803

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma

  Study EGAS50000000313

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146

• metastatic uveal melanoma tumour biopsies

  Tumour biopsies were obtained from uveal melanoma patients pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000864

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• A neoadjuvant, phase II trial demonstrates efficacy and tolerability of Talimogene laherparepvec in cutaneous basal cell carcinoma (NeoBCC trial)

  We present a single arm, phase II neoadjuvant trial with the oncolytic virus Talimogene laherparepvec (T-VEC) in 18 patients with difficult-to-resect basal cell carcinomas. Six cycles of T-VEC were applied intralesionally. The primary endpoint of the study, defined as the proportion of the patients, who after six cycles of T-VEC (13 weeks) at the time point of surgery, become resectable with primary wound closure without the need for plastic reconstructive surgery like skin flaps or skin grafts, was achieved (9/18 patients; 50.0%). Secondary endpoints also included the relapse free survival rate (100%), overall survival (100%) and biological read outs in the tumor samples. T-VEC led to a significant increase of cytotoxic T cells, B cells and myeloid cells, and a decrease of Tregs within the tumor microenvironment. We observed a potent induction of antitumoral and antiviral T cell clones, as well as a strong humoral immune response. The objective response rate was 55.6% and the complete pathological response rate was 33.3%. Only mild adverse events occurred. Together, neoadjuvant T-VEC represents a viable treatment option for patients with difficult-to-resect BCCs (EudraCT Number 2018-002165-19).

  Study EGAS50000000252

• Epigenetic landscape reorganization and reactivation of embryonic development genes are associated with malignancy in IDH-mutant astrocytoma

  Accurate grading of IDH-mutant gliomas is crucial for determining patient prognosis and guiding treatment decisions. However, histological grading can be challenging, so we aimed to identify objective molecular markers. To this end, we conducted bulk RNA sequencing on primary IDH-mutant astrocytomas (n=138) from the prospective CATNON trial, which evaluated the prognostic impact of adjuvant and concurrent temozolomide. Using this data, we sought to identify molecular markers linked to increased malignancy in IDH-mutant astrocytomas to establish objective grading criteria.

  Study EGAS50000000381

• Whole exome sequencing of pre-invasive lung adenocarcinoma in non-smokers

  The prevalence of lung adenocarcinoma (LUAD) has increased sharply in East Asia. Early diagnosis leads to better survival rates, but this requires an improved understanding of the molecular changes during early tumorigenesis, particularly in non-smokers. We performed whole exome-sequencing and RNA-sequencing for samples from 94 East Asian patients with precancerous lesions (25 with atypical adenomatous hyperplasia [AAH]; 69 with adenocarcinoma in situ [AIS]) and 73 patients with early invasive lesions (minimally invasive adenocarcinoma [MIA]). Cellular analysis revealed that the activities of endothelial and stromal cells could categorize tumors into molecular subtypes within pathology-defined lesion types. These subtypes were linked with the advanced radiology-defined lesion type and coordinated with immune cell infiltration throughout the progression of LUAD. Characterization of these lesion types identified positively selected mutation patterns, and suggested that angiogenesis of the late-stage AIS type potentially contributes to tissue invasion of the MIA type. Our findings offer a novel resource that may help to improve early diagnosis and patient prognosis, and also suggest possible approaches for early disease interception.

  Study EGAS50000000438