12055 results for "cancer rna-seq"

in 13.92 milliseconds.

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604