11979 results for "cancer rna-seq"

in 20.05 milliseconds.

• The genomic landscape of follicular and diffuse large B-cell lymphoma

  As part of the ICGC, the ICGC MMML-Seq project performed whole genome sequencing and RNA sequencing of follicular and diffuse large B-cell lymphoma. Follicular and diffuse large B-cell lymphomas are the most common B-cell lymphomas in adulthood. Analyses were performed in concordance with the guidelines of the ICGC. The results define the genomic landscape of structural variants, somatic single nucleotide variants and mutational signatures in these lymphomas

  Study EGAS00001002199

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Influence of culture media on airway differentiation at the Air-Liquid Interface

  Single-cell dataset of human airways after in vitro regeneration at the Air-Liquid Interface. Samples from 2 donors were used for the establishment of Human Bronchial Epithelial Cell cultures (HBECs) and were analyzed during proliferation, at the onset of differentiation (ALI0) and after full differentiation (ALI28), in 4 distinct culture media. Single-cell RNAseq was performed with 10x Genomics 3’ v2 RNA-seq using hashtag antibodies for multiplexing, and sequenced on a NextSeq 500. Samples from 3 additional donors were used for the establishment of Human Nasal Epithelial Cell cultures (HNECs) and were analyzed during proliferation in three distinct culture media. Single-cell RNAseq was performed with 10x Genomics 3’ v3 RNA-seq without multiplexing, and sequenced on a NextSeq 2000.

  Dataset EGAD00001011362

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• Perturb-seq dataset

  We performed a systematic, genome-wide investigation of enhancer regions in colorectal cancer (CRC). We identified 12,117 putative enhancer regions using H3K27ac and H3Kme1 ChIP-seq and ATAC-seq. We performed scRNA-seq in HT29 and SW480 (MSS CRC cell lines) using the Parse Biosciences WT-mega kit with CRISPRi/dCas9 inhibition of these regions (Perturb-seq). The Parse split-pipe pipeline was used to demultiplex the raw fastq files into the processed files (mtx files for genes and gRNA) for each cell line.

  Dataset EGAD50000000375

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)

  Systemic pan-tumor analyses may reveal the significance of common features implicated in cancer immunogenicity and patient survival. Here, we provide a comprehensive multi-omics data set for 32 patients across 25 tumor types for proteogenomic-based discovery of neoantigens. By using an optimized computational approach, we discover a large number of tumor-specific and tumor-associated antigens. To create a pipeline for the identification of neoantigens in our cohort, we combine DNA and RNA sequencing with MS-based immunopeptidomics of tumor specimens, followed by the assessment of their immunogenicity and an in-depth validation process. We detect a broad variety of non-canonical HLA-binding peptides in the majority of patients demonstrating partially immunogenicity. Our validation process allows for the selection of 32 potential neoantigen candidates. The majority of neoantigen candidates originates from variants identified in the RNA data set, illustrating the relevance of RNA as a still understudied source of cancer antigens. This study underlines the importance of RNA-centered variant detection for the identification of shared biomarkers and potentially relevant neoantigen candidates.

  Study EGAS00001006706

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• Validated Single-cell RNA sequencing in early breast cancer

  Single-cell RNA and VDJ sequencing of early breast cancer

  Dataset EGAD00001006608

• Targeted gene fusion sequencing (Fus-seq) in mesothelioma

  This is a small pilot data set to test the feasibility of cDNA exomes across 1200 cancer cell line panel. cDNA exomes or Fus-seq is further explained in this studies Abstract.

  Dataset EGAD00001000361

• Comprehensive molecular phenotyping of ARID1A-deficient gastric cancer reveals pervasive epigenomic reprogramming and therapeutic opportunities

  This dataset includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset.

  Dataset EGAD50000000660

• Multiregion Whole Exome and Smart-Seq3 single cell RNA sequencing of Breast Tumors

  Multiple regions were cut out of each tumor extracted form breast cancer patients and two experiments were run: - Whole exome sequencing on each of the regions plus an adjacent normal tissue sample - Smart-Seq3 Single cell RNA sequencing on EPCAM+ CD45- sorted cells from different tumor regions

  Study EGAS00001006851

• SGCC GASCAD-II dataset

  The GASCAD-II dataset from the Singapore Gastric Cancer Consortium includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset

  Dataset EGAD00001015433

• Common Deleterious Germline Variants Shape the Urothelial Cancer Genome

  Our study used whole-exome, whole-genome, and RNA sequencing to analyze samples from primary tumors, locally recurrent or metastatic urothelial tumors collected over time, and matched normal urothelium. We described the molecular landscape of mutational signatures and structural variants in chemotherapy-resistant urothelial cancer.

  Study phs001087