11976 results for "cancer rna-seq"

in 42.97 milliseconds.

• Djerroudi et al., E-cadherin inactivation shapes tumor microenvironment specificities in invasive lobular carcinoma

  Invasive lobular breast carcinoma (ILC) shows specific stromal features, T lymphocyte infiltration (TIL) being associated with poor prognosis. Here, we reveal the involved mechanism by performing single cell RNA sequencing, combined immunohistochemistry, deconvolution of bulk RNA sequencing from large retrospective ILC series, and functional assays using primary cells. We show that ILC accumulate FAP+ inflammatory cancer-associated fibroblasts (iCAF) through a previously undescribed mechanism mediated by E-cadherin/CDH1 on CAF plasticity. Indeed, CDH1 inactivation in ILC cancer cells prevents differentiation of iCAF into myofibroblastic CAF (myCAF), leading to iCAF accumulation. In turn, iCAF increase TIL infiltration and shape their spatial organization in ILC. Subsequently, CDH1-inactivated ILC cancer cells promote immune escape by lack of retention and activation of ITGAE-expressing resident memory CD8+ T lymphocytes (TRM). Hence, our study uncovers reciprocal interactions between CDH1-inactivated cancer cells, iCAF and CD8+ TRM, revealing why and how TILs have a poor prognosis in ILC patients, a mechanism extrapolated to other CDH1-mutated cancer types.

  Study EGAS50000000761

• RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

  RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

  Dataset EGAD50000001614

• Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

  Dataset EGAD50000001664

• NeoRhea Bulk RNA and Single nuclei RNA & ATAC

  The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

  Study EGAS50000001403

• Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

  Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

  Study EGAS00001002185

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• Genetic coupling of enhancer activity and connectivity in gene expression control

  In this study, we investigated whether the genetic effects of eQTLs on enhancer activity and enhancer-promoter contacts (connectivity) are inherently coupled or distinct. To address this, we performed Capture Hi-C targeting ~1100 eQTL loci, along with ATAC-seq and RNA-seq, in monocytes from 34 healthy male donors. Using single-modality and multi-modality Bayesian statistical approaches, we demonstrated that eQTL effects are predominantly shared across enhancer activity, connectivity, and gene expression. However, we also identified a locus where an eQTL disrupts a CTCF binding site at a putative insulator, facilitating contacts between the PCK2 gene promoter and downstream enhancers. To validate these findings, we used 4C-seq to confirm the allelic effects of eQTLs on enhancer-promoter connectivity at the PCK2 locus and another eQTL region associated with THBS1 expression, both of which showed consistent eQTL effects across all three modalities. Additionally, we conducted Hi-C on monocytes from two donors to map reference TADs and performed ChIP-seq to confirm the allelic effects of the PCK2 eQTL on CTCF binding. Together, these data provide comprehensive insights into the genetic coupling of enhancer activity, connectivity, and gene expression.

  Study EGAS50000000756

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Single Cell RNA-Sequencing in Adenoid Cystic Carcinoma

  This study of salivary adenoid cystic carcinoma aimed to profile individual malignant and stromal cells in treatment-naive head and neck adenoid cystic carcinoma, with or without metastatic cervical lymph nodes. Clinical and pathologic information was collected on all patients, in addition to a fresh biopsy sample from the primary tumor and/or metastatic lymph node at the time of initial surgery. A fresh biopsy sample from a matched local recurrence was also collected for a single unique patient. Biopsy specimens were processed for single cell RNA-seq. A total of ~1,700 single cells from seven participants were included in the final dataset.

  Study phs003070

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: LIRI-JP.

  Dataset EGAD00001003547

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: CLLE-ES.

  Dataset EGAD00001003548

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: CLLE-ES.

  Dataset EGAD00001003549

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: RECA-EU.

  Dataset EGAD00001003559

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: PACA-AU.

  Dataset EGAD00001003411

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: PACA-AU.

  Dataset EGAD00001003410

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: MALY-DE.

  Dataset EGAD00001003560

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: MALY-DE.

  Dataset EGAD00001003561

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: RECA-EU.

  Dataset EGAD00001003558

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: OV-AU.

  Dataset EGAD00001003415

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: OV-AU.

  Dataset EGAD00001003416

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: LIRI-JP.

  Dataset EGAD00001003546

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• The evolutionary dynamics of human colorectal cancer using single-gland spatial multi-omic profiling of DNA, RNA and chromatin.

  Deciphering the mechanisms of colorectal cancer growth, progression and dissemination in each individual patient.

  Study EGAS00001005230

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• HuBMAP: Single-Cell Data from Human Tissues

  The small bowel and colon are organs critical for maintaining homeostasis of the human body by mediating nutritional absorption upon the ingestion of food. Though both organs are extensive in length, there are known differences in function and cellular heterogeneity within different portions of each. Also, a cross section anywhere in the bowel reveals a complex layering of components involved in absorption and secretion, motility of gut contents, circulation, and immunity. We are mapping the complexity of the the small bowel and colon with cell-to-cell resolution in histologic sections, both along their lengths and across multiple individuals. Our molecular data consist of single cell ATAC-seq and RNA-seq. These profiles are spatially mapped to histologic sections using CO-Detection by indEXing (CODEX), a highly multiplexed system of antibody-tagged target epitopes.

  Study phs002272

• Dysregulation of Naive T Cell Quiescence during Aging

  TEA-seq (novel trimodal single-cell analysis of mRNA transcripts, surface protein epitopes, and chromatin accessibility) was performed on CD3+ T cells isolated from peripheral blood of healthy pediatric (11–13 yrs, n = 8) and older adult (55–65 yrs, n = 8) female donors. Single-cell RNA sequencing (scRNA-seq) was additionally performed on peripheral blood mononuclear cells (PBMCs) from a healthy cohort of 16 pediatric, 16 young adult (25–35 yrs), and 16 older adult donors with equal sex distribution. Using these data, we dissected the compositional and molecular alterations within the T cell compartment across the spectrum of healthy age, showing broad transcriptional and epigenetic alterations within the T cell compartment of older adults compared to children, as well as a novel population of pediatric-specific CD8aa T cells.

  Study phs003400

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• Differential Presence of Exons in Cell-Free DNA Reveals Different Patterns in Colorectal Cancer Between Metastatic and Non-Metastatic Patients

  Tumor genotyping during disease follow-up is gaining an increasing interest for monitoring and clinical management in colorectal cancer (CRC). Growing evidences suggest that single biopsies are inefficient for molecular profiling, due to clonal evolution and intratumoral heterogeneity of primary tumors and/or metastasis. Circulating free DNA (cfDNA) has emerged as an alternative source of genetic material that seems to be representative of the continuously changing tumor molecular features. Thus, the so-called 'liquid biopsy' also offers the additional advantages of accessibility and non-invasiveness for the patient. Novel strategies based on next-generation sequencing (NGS) of cfDNA are being currently developed, with most studies focusing on targeted deep sequencing panels of potential clinically actionable genes. Here we describe an alternative approach, consisting of exome-sequencing in cfDNA at a relatively shallower depth to provide a more general overview of the circulating genome. In this study, two groups of colorectal cancer patients, with either disseminated (M) or localized disease (N), were compared using whole-exome sequencing and a RNA-seq bioinformatics analysis pipeline. Thus, a set of 379 exons present at different levels in cfDNA from both groups were identified, giving rise to a completely new concept in this field, termed as 'Differential Presence of Exons'. Differentially present exons (DPEs) were subsequently used for M and N patients clustering and classification, allowing for the design of a predictive algorithm with encouraging preliminary results in a small subset of patients that could not be initially classified attending to the selection criteria (U group, unassignable).

  Study EGAS00001002687

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474