11750 results for "cancer rna-seq"

in 21.90 milliseconds.

• DAC for study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer."

  This is Data Access Committee will oversee data sharing for sequence data in the EGA study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer." This dataset includes 116 bam files from whole exome sequencing on the Illumina HiSeq2500, 102 fastq files from RNA sequencing on the Illumina NovaSeq 6000. The samples analyzed include tumor/normal DNA samples and tumor RNA samples from 72 individuals with non-small cell lung cancer treated with pembrolizumab and SBRT or pembrolizumab alone on the NCT02492568 trial.

  Dac EGAC50000000202

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• Somatic L1 retrotransposition dynamics in high-grade serous ovarian cancer

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from same patient were utilised to understand L1-mediated intrapatient heterogeneity.

  Study EGAS50000001198

• ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001231

• ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001230

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001233

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001229

• ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001232

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001234

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001959

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

  RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

  Dataset EGAD50000001614

• Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

  Dataset EGAD50000001664

• NeoRhea Bulk RNA and Single nuclei RNA & ATAC

  The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

  Study EGAS50000001403

• Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

  Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

  Study EGAS00001002185

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• RNA, ATAC, ChIP datasets from iPSC Derived Macrophages with and without TNFRSF1A intronic deletion using CRISPR

  This dataset consists of functional genomic data from iPSC derived Macrophages with or without CRISPR deletions and controls. It contains 21 paired end fastq files consisting of 6 total RNA-seq samples and 9 ATAC samples, for ChIP there are 2 H3K4me3 samples, 2 H3K27ac samples along with 2 paired input samples. The samples were sequenced on the Illumina HiSeq4000 amd Illumina NextSeq500 platforms.

  Dataset EGAD50000000984

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• Long-read single-cell RNA-seq in COVID-19

  We report the first application of long-read single-cell RNA sequencing on nasopharyngeal swabs from COVID-19 patients and healthy controls to resolve transcript-level changes across cell types. Samples were collected from three patients with moderate COVID-19, six patients with critical COVID-19, and three healthy controls. Single-cell libraries were generated using the 10x Genomics Chromium 3' protocol, producing unfragmented cDNA. Libraries were sequenced on the Oxford Nanopore Technologies PromethION platform. Basecalling was performed with Guppy (v1.6), generating a single FASTQ file per sample.

  Dataset EGAD50000001836

• Integrated Exome-seq analysis of tumor thrombus

  We prospectively enrolled 83 patients with a renal mass and TT scheduled to undergo surgical resection. To accurately integrate genomic and transcriptomic findings and enable histological co-registration, simultaneous isolation of DNA and RNA was performed from individual samples characterized histologically through immediately flanking sections

  Study EGAS00001005511

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• RNAseq of human fetal pancreas development

  The dataset comprises RNA-seq information of 4 subpopulations sorted from human fetal pancreas of 3 different donors. Low input libraries were generated using the Smart-seq2 protocol after Ampure XP cleanup of the total RNA extracted from the sorted cells. Libraries were multiplexed and sequenced paired-end over 2 lanes of HiSeq4000 each. Raw data was aligned to the human genome refernence GRCh37 using STAR v2.5.1b with GENCODE v19 as transcriptome reference, and unaligned reads were folded into the final uploaded bams.

  Dataset EGAD00001004210

• RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells

  RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells. RNAseq was performed using 200 ng of total RNA by GATC Biotech. Directional libraries were performed after mRNA selection by polyA selection using UTP method. RNA-seq libraries were sequenced on HiSeq2500 Illumina machine using 100bp paired-end reads. Reads alignment was performed using the STAR aligner (version 2.4.0f1) and human genome hg19 as reference.

  Dataset EGAD00001007813

• Kidney_tumour_DNA

  This is a bulk DNA and RNA sequencing study of human renal tumours

  Study EGAS00001002486

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: LIRI-JP.

  Dataset EGAD00001003547

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: CLLE-ES.

  Dataset EGAD00001003548

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: CLLE-ES.

  Dataset EGAD00001003549

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: RECA-EU.

  Dataset EGAD00001003559

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: PACA-AU.

  Dataset EGAD00001003410

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: PACA-AU.

  Dataset EGAD00001003411

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: MALY-DE.

  Dataset EGAD00001003560

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: MALY-DE.

  Dataset EGAD00001003561

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604