12221 results for "cancer rna-seq"

in 21.03 milliseconds.

• Genetic coupling of enhancer activity and connectivity in gene expression control

  In this study, we investigated whether the genetic effects of eQTLs on enhancer activity and enhancer-promoter contacts (connectivity) are inherently coupled or distinct. To address this, we performed Capture Hi-C targeting ~1100 eQTL loci, along with ATAC-seq and RNA-seq, in monocytes from 34 healthy male donors. Using single-modality and multi-modality Bayesian statistical approaches, we demonstrated that eQTL effects are predominantly shared across enhancer activity, connectivity, and gene expression. However, we also identified a locus where an eQTL disrupts a CTCF binding site at a putative insulator, facilitating contacts between the PCK2 gene promoter and downstream enhancers. To validate these findings, we used 4C-seq to confirm the allelic effects of eQTLs on enhancer-promoter connectivity at the PCK2 locus and another eQTL region associated with THBS1 expression, both of which showed consistent eQTL effects across all three modalities. Additionally, we conducted Hi-C on monocytes from two donors to map reference TADs and performed ChIP-seq to confirm the allelic effects of the PCK2 eQTL on CTCF binding. Together, these data provide comprehensive insights into the genetic coupling of enhancer activity, connectivity, and gene expression.

  Study EGAS50000000756

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• RoCK and ROI single-cell transcriptome of one acute lymphoblastic leukemia patient

  Whole-transcriptome single-cell RNA sequencing (scRNA-seq) was performed following the manufacturer’s protocol (BD Rhapsody, BD Biosciences). Targeted enrichment of BCR::ABL1 transcripts was conducted using the RoCK and ROI-seq approach, based on the barcoded bead technology of the BD Rhapsody platform. In the RoCK and ROI-seq workflow, the template-switch oligonucleotides (TSOs) attached to BD Rhapsody beads were modified with one or multiple capture sequences specific to transcripts of interest, enabling targeted transcript capture during reverse transcription. ROI primers that are added during library preparation to direct amplification and sequencing toward these defined regions of interest (ROIs). Resulting libraries were sequenced on an Illumina sequencer.

  Dataset EGAD50000001976

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• scRNA-seq of a 3D human cortical tissue model from human iPSCs exploring 2D versus 3D co-culturing

  Single-cell RNA-seq analysis of human iPSC-derived microglia/astrocytes/neurons in a novel, human in vitro 3D cortical tissue model, as well as 2D co-cultures for comparison. Samples include distinct conditions as described in the Study section. The dataset was generated using the BD Rhapsody technology and sequenced paired-end with Illumina NovaSeq2000. Information on the multiplexing of samples is reported in the Analyses section.

  Dataset EGAD50000002021

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• RIP-SeqRaw data

  This dataset contains 15 paired FASTQ files from the PTBP1 project. Sequencing data were generated using bulk directional RNA-seq and RIP-seq experiments performed on a NovaSeq 6000 platform (2×100 bp paired-end reads). The dataset comprises two groups of samples: controls and patients. For each group, both input and immunoprecipitated samples are available. Patient samples correspond to skin biopsies from individuals affected by a neurodevelopmental disorder associated with variable skeletal dysplasia and disproportionate short-limbed short stature.

  Dataset EGAD50000001723

• Sequencing data of the ampulla and fimbriae of the fallopian tube in pre-menopausal women

  A total of 10 pre-menopausal patients were recruited for this study. Sequencing of both the fimbriae and ampullary region of the fallopian tubes was performed using 10x Genomics single-cell RNA-seq and ATAC-seq. For one patient, data were sequenced across 4 lanes, while the remaining patients' data were sequenced in 2 lanes each, resulting in a total of 44 sequencing datasets for each platform.

  Dataset EGAD50000000889

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• mRNA-Seq on single human MII oocytes collected from gonadotropin stimulated women

  This dataset contains 11 paired-end FASTQ sequences from mRNA-Seq on single human M-II stage oocytes that were collected from gonadotropin stimulated women undergoing fertility treatments. M-II stage oocytes were collected and flash frozen prior to lysis followed by RNA extraction, full length cDNA preparation and amplification using the Ultra-low-input SMART-Seq2 v4 kit from Takara Clonetech. Further, these cDNA were used to prepare libraries for sequencing according the Nextera XT DNA library preparation kit from Illumina.

  Dataset EGAD00001006863

• Advanced Genetic and Molecular Analysis of Solid Tumors

  This study is designed to understand the role of immunosuppressive regulatory B cells (Breg) in pancreatic cancer. Breg and conventional B cells (Bcon) from patients are compared by RNA sequencing analysis. Bregs and Bcon were isolated from freshly isolated PBMCs in peripheral blood. These data represent the examination of differentially expressed genes in these two blood-derived B cell subsets from both healthy and pancreatic cancer patients.

  Study phs001999

• HuBMAP: Single-Cell Data from Human Tissues

  The small bowel and colon are organs critical for maintaining homeostasis of the human body by mediating nutritional absorption upon the ingestion of food. Though both organs are extensive in length, there are known differences in function and cellular heterogeneity within different portions of each. Also, a cross section anywhere in the bowel reveals a complex layering of components involved in absorption and secretion, motility of gut contents, circulation, and immunity. We are mapping the complexity of the the small bowel and colon with cell-to-cell resolution in histologic sections, both along their lengths and across multiple individuals. Our molecular data consist of single cell ATAC-seq and RNA-seq. These profiles are spatially mapped to histologic sections using CO-Detection by indEXing (CODEX), a highly multiplexed system of antibody-tagged target epitopes.

  Study phs002272

• Dysregulation of Naive T Cell Quiescence during Aging

  TEA-seq (novel trimodal single-cell analysis of mRNA transcripts, surface protein epitopes, and chromatin accessibility) was performed on CD3+ T cells isolated from peripheral blood of healthy pediatric (11–13 yrs, n = 8) and older adult (55–65 yrs, n = 8) female donors. Single-cell RNA sequencing (scRNA-seq) was additionally performed on peripheral blood mononuclear cells (PBMCs) from a healthy cohort of 16 pediatric, 16 young adult (25–35 yrs), and 16 older adult donors with equal sex distribution. Using these data, we dissected the compositional and molecular alterations within the T cell compartment across the spectrum of healthy age, showing broad transcriptional and epigenetic alterations within the T cell compartment of older adults compared to children, as well as a novel population of pediatric-specific CD8aa T cells.

  Study phs003400

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• RNA sequencing of untreated and treated KRAS-mutated metastatic colorectal cancer PDX-derived organoids.

  RNA sequencing was performed on patient-derived xenograft (PDX)-derived organoid models of metastatic colorectal cancer (mCRC). The aim of this study was to characterize the transcriptional landscape of KRAS-mutant mCRC cells in response to therapeutic strategies targeting the EGFR and KRAS signaling pathways. Transcriptomic profiling was conducted following drug treatments to investigate molecular changes associated with single and combination therapies. A total of 24 samples were analyzed.

  Dataset EGAD50000002443

• RNA-Sequencing of cervical cancers

  We used RNA sequencing of 81 cervical cancer specimens to developed an immune-based gene expression signature to predict distant metastasis in cervical cancer patients treated with RT/cisplatin. Our 55-gene risk score, validated across independent cohorts, was strongly linked to higher rates of metastasis and lower survival. The score also correlated with higher copy-number alteration and a less immune-responsive tumor microenvironment, indicating its potential in identifying high-risk patients and informing targeted therapies.

  Dataset EGAD50000000120

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• GBM-ZEB1: RNA sequencing of parental tumors used for cell line generation

  This dataset contains RNA sequencing raw data from four parental tumors that were used for classification of gene expression subtypes (Verhaak, Cancer Cell 2010) using ssGSEA.

  Dataset EGAD00001001627

• E-cadherin inactivation shapes tumor microenvironment specificities in invasive lobular carcinoma

  Invasive lobular breast carcinoma (ILC) shows specific stromal features, T lymphocyte infiltration (TIL) being associated with poor prognosis. Here, we reveal the involved mechanism by performing single cell RNA sequencing, combined immunohistochemistry, deconvolution of bulk RNA sequencing from large retrospective ILC series, and functional assays using primary cells. We show that ILC accumulates FAP+ inflammatory cancer-associated fibroblasts (iCAF) through a previously undescribed mechanism mediated by E-cadherin/CDH1 on CAF plasticity. Indeed, CDH1 inactivation in ILC cancer cells prevents differentiation of iCAF into myofibroblastic CAF (myCAF), leading to iCAF accumulation. In turn, iCAF attract TILs into the tumor center and shape their spatial organization in ILC. Subsequently, CDH1-inactivated ILC cancer cells promote immune escape by lack of retention and activation of ITGAE-expressing resident memory CD8+ T lymphocytes (TRM). Hence, our study uncovers reciprocal interactions between CDH1-inactivated cancer cells, iCAF and CD8+ TRM, gaining insight into the underlying mechanism associated with the distinctive stromal reaction observed in ILC and revealing why and how TILs have a poor prognosis in ILC patients, a mechanism that can be generalized to other CDH1-inactivated cancer types.

  Study EGAS50000001760

• RNA-sequencing data from metastatic Castration-Resistant Prostate Cancer (mCRPC)

  The goal of this study is to characterize the transcriptional landscape of advanced prostate cancer

  Study EGAS00001005954

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• RNA Editing in breast cancer

  High-throughput sequencing screens suggest that RNA editing, which consists in the substitution of adenosine with inosine by the RNA-specific adenosine deaminase (ADAR) enzyme, occurs at several thousand positions across the human genome. Recent evidences have shown that RNA-editing could promote proliferation and carcinogenesis; however, the general principles of ADAR activity on the transcriptome and how ADAR is controlled in cancers remain to be established. The main aim of this project was to investigate the phenomenon of RNA editing in breast and other cancers. The frequency of A-to-I editing was evaluated in 58 breast cancers equally distributed among the different molecular subtypes and 10 normal breast tissues. The analysis was focused on defining: the relationship between the global amount of editing and ADAR expression; the ability to predict the level of editability of specific sites; the distribution of editing in normal and tumour samples and among different breast cancer subtypes; and the clinical, pathological and genomic factors affecting editing.

  Study EGAS00001000495

• Upcycling and merging data to challenge the dogma and identify new therapeutic targets for Glioblastoma

  Glioblastoma is the most common brain tumour. Characterised by a poor prognosis and its recurrence after multimodal treatments, the search for preventable risk factors has been mainly inconclusive up to date. Recently, the data merge from datasetsdeposited at the EGA allowed Aaron Diaz’s team to discover that the glioblastoma cells shift toward a mesenchymal phenotype when the tumour is recurring. Challenges in glioblastoma research As for virtually all cancer types, many efforts have been made to unveil the molecular features responsible of the disease, and several cellular pathways have indeed been identified as being frequently mutated in glioblastoma. Nonetheless, targeted therapies based on identified genes have so far failed to improve outcome, thus survival mostly relies on a standard treatment unchanged since 2005. This is a frustrating situation for both the scientific and medical communities, and above all for the patients, still facing a dreadful path. Some researchers hypothesised that this may be due to the inability to efficiently target cancer stem cells, the originators of the other cell types, thus inducing cancer relapse. In 2019 Charles P. Couturier and colleagues sequenced RNA from single cells of freshly excised glioblastomas of 16 patients, and demonstrated that glioblastoma cells replicate normal brain cell development with a conserved neural cancer cell hierarchy centered around glial progenitor-like cells. In this way, they helped identify the possible target cells to improve efficacy and durability of treatment. Data upcycling at the EGA: the glioblastoma case study Single cell RNA sequencing is generated with a laborious and expensive protocol. The quality of the starting material is crucial (cells sample freshly extracted from the patients) and often several attempts are needed before producing reliable quality sequencing results. Collecting big numbers of patients is also challenging. The sequencing data produced by Kevin Petrecca’s group in Montreal, Canada and deposited at the EGA (EGAS00001004422) was recently upcycled by Lin Wang in San Francisco, California and pooled with their freshly produced ones, and then deposited at the EGA as Dataset EGAS00001004909 The data merge allowed Aaron Diaz’s team to discover that the glioblastoma cells shift toward a mesenchymal phenotype when the tumour is recurring. They profiled 86 primary-recurrent patient-matched paired glioblastoma samples with single-nucleus RNA, among other techniques. These very comprehensive results lead the team to challenge the findings from several other cancer fields where chemotherapy standard chemo-radiation therapy selection pressure at the level of genomic alterations; this is indeed not the case for glioblastoma, where the pressure results in phenotypic transition between cellular states. Several technical controls were made to ensure that the merge of the data was not introducing a bias in the results, and an Inter-table analysis demonstrated nearly equal contribution to overall variance from each of the studies included, indicating that the findings were not due to inter-laboratory technical effect. A novel principal-component analysis showed that the largest contribution to variation in primary glioblastoma neoplastic cells was an axis between MES (mesenchymal) and proneural expression programs. In summary, treating glioblastoma often makes a MES, as commented by Lucy Stead about this remarkable work. Check Aaron Diaz’s team Nature Cancer paper, with strong technical tools, state of the art analysis and data from different sources converging to the same outcomes that made possible a significant step toward a better handling of a frightful cancer. References Couturier, C.P., Ayyadhury, S., Le, P.U. et al. Single-cell RNA-seq reveals that glioblastoma recapitulates a normal neurodevelopmental hierarchy. Nat Commun 11, 3406 (2020). Stead, L.F. Treating glioblastoma often makes a MES. Nat Cancer 3, 1446–1448 (2022). Wang, L., Jung, J., Babikir, H. et al. A single-cell atlas of glioblastoma evolution under therapy reveals cell-intrinsic and cell-extrinsic therapeutic targets. Nat Cancer 3, 1534–1552 (2022). Related links: Kevin Petrecca’s group dataset deposited at the EGA: EGAS00001004422 Lin Wang dataset deposited at the EGA: EGAS00001004909

  Blog upcycling-and-merging-data-to-challenge-glioblastoma

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Integrated Exome-seq analysis of tumor thrombus

  We prospectively enrolled 83 patients with a renal mass and TT scheduled to undergo surgical resection. To accurately integrate genomic and transcriptomic findings and enable histological co-registration, simultaneous isolation of DNA and RNA was performed from individual samples characterized histologically through immediately flanking sections

  Study EGAS00001005511

• Long-read single-cell RNA-seq in COVID-19

  We report the first application of long-read single-cell RNA sequencing on nasopharyngeal swabs from COVID-19 patients and healthy controls to resolve transcript-level changes across cell types. Samples were collected from three patients with moderate COVID-19, six patients with critical COVID-19, and three healthy controls. Single-cell libraries were generated using the 10x Genomics Chromium 3' protocol, producing unfragmented cDNA. Libraries were sequenced on the Oxford Nanopore Technologies PromethION platform. Basecalling was performed with Guppy (v1.6), generating a single FASTQ file per sample.

  Dataset EGAD50000001836

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• RNAseq of human fetal pancreas development

  The dataset comprises RNA-seq information of 4 subpopulations sorted from human fetal pancreas of 3 different donors. Low input libraries were generated using the Smart-seq2 protocol after Ampure XP cleanup of the total RNA extracted from the sorted cells. Libraries were multiplexed and sequenced paired-end over 2 lanes of HiSeq4000 each. Raw data was aligned to the human genome refernence GRCh37 using STAR v2.5.1b with GENCODE v19 as transcriptome reference, and unaligned reads were folded into the final uploaded bams.

  Dataset EGAD00001004210

• Integrated analysis of whole genome and RNA sequencing in 22 HBV-associated HCCs

  RIKEN collection WGS and RNA-seq reads for 66 HBV-associated HCC and matched blood or liver samples from 22 donors.

  Dataset EGAD00001001035

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• RNA-seq bulk

  This dataset gather all RNA-sequencing data in MM.1S cell line in control and Dex condition; both in 3 biological replicates

  Dataset EGAD00001011137

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Clonal Evolution and Heterogeneity of Osimertinib Acquired Resistance Mechanisms in EGFR Mutant Lung Cancer

  Current understanding of acquired resistance to osimertinib in EGFR-mutant lung cancer is largely based on the use of targeted sequencing platforms and cell-free DNA. In this study we examined the clonal evolution and heterogeneity of acquired resistance mechanisms to osimertinib through whole exome and RNA-sequencing of prospectively collected pre-and post-osimertinib resistant tumors and metastases at rapid autopsy. We enrolled 34 patients with histologically confirmed EGFR mutant advanced lung adenocarcinoma in a prospective Phase II clinical trial to evaluate osimertinib treatment and the use of local ablative therapy (LAT) for oligoprogressive disease (NCT02759835) in EGFR mutant NSCLC from April 2016 until data cutoff in September 2019. Patients were not selected based on oligometastatic status, rather 32/34 patients had multiple organ involvement, including lung, liver, adrenal, brain and bone. Biopsies or surgeries were performed pre-osimertinib treatment and at first progression on osimertinib. A subset of patients also underwent biopsies at second progression on osimertinib, and following end of life in-patient hospice and rapid autopsy upon death. 63% (n=15/24) of first-line osimertinib and 50% (n=5/10) of second-line osimertinib treated patients had RECIST defined partial response. Overall, 21 patients had RECIST defined first progression on osimertinib. Two patients on this trial discontinued treatment and were lost to follow up. Of the 21 patients who had RECIST defined progression, 14 patients underwent LAT (8 first-line and 6 second-line). Twelve patients had paired pre- and post-osimertinib resistant tumors and three had post-osimertinib resistant tumors available for analysis. Four patients (LAT002, LAT006, LAT014 and LAT021) consented for a rapid autopsy protocol and underwent rapid autopsy after deatH. To elucidate acquired osimertinib resistance mechanisms, we performed whole-exome (WES), targeted sequencing and RNA-seq on 66 tumors and matched germline DNA from tumor tissue obtained from a total of 15 patients.

  Study phs002001

• RNA sequencing data of high-grade serous ovarian cancer samples

  RNA sequencing data of over 200 HGSOC samples at diagnosis, after chemotherapy and during progression.

  Dataset EGAD00001006456