11979 results for "cancer rna-seq"

in 13.89 milliseconds.

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Sequencing data of the ampulla and fimbriae of the fallopian tube in pre-menopausal women

  A total of 10 pre-menopausal patients were recruited for this study. Sequencing of both the fimbriae and ampullary region of the fallopian tubes was performed using 10x Genomics single-cell RNA-seq and ATAC-seq. For one patient, data were sequenced across 4 lanes, while the remaining patients' data were sequenced in 2 lanes each, resulting in a total of 44 sequencing datasets for each platform.

  Dataset EGAD50000000889

• RIP-SeqRaw data

  This dataset contains 15 paired FASTQ files from the PTBP1 project. Sequencing data were generated using bulk directional RNA-seq and RIP-seq experiments performed on a NovaSeq 6000 platform (2×100 bp paired-end reads). The dataset comprises two groups of samples: controls and patients. For each group, both input and immunoprecipitated samples are available. Patient samples correspond to skin biopsies from individuals affected by a neurodevelopmental disorder associated with variable skeletal dysplasia and disproportionate short-limbed short stature.

  Dataset EGAD50000001723

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• scRNA-seq of a 3D human cortical tissue model from human iPSCs exploring 2D versus 3D co-culturing

  Single-cell RNA-seq analysis of human iPSC-derived microglia/astrocytes/neurons in a novel, human in vitro 3D cortical tissue model, as well as 2D co-cultures for comparison. Samples include distinct conditions as described in the Study section. The dataset was generated using the BD Rhapsody technology and sequenced paired-end with Illumina NovaSeq2000. Information on the multiplexing of samples is reported in the Analyses section.

  Dataset EGAD50000002021

• mRNA-Seq on single human MII oocytes collected from gonadotropin stimulated women

  This dataset contains 11 paired-end FASTQ sequences from mRNA-Seq on single human M-II stage oocytes that were collected from gonadotropin stimulated women undergoing fertility treatments. M-II stage oocytes were collected and flash frozen prior to lysis followed by RNA extraction, full length cDNA preparation and amplification using the Ultra-low-input SMART-Seq2 v4 kit from Takara Clonetech. Further, these cDNA were used to prepare libraries for sequencing according the Nextera XT DNA library preparation kit from Illumina.

  Dataset EGAD00001006863

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• Single nuclei RNA-Seq from 5 regions of the human fetal brain

  Data generated through single nuclei RNA sequencing on 5 regions of the brain (frontal cortex, ganglionic eminence, hippocampus, thalamus and cerebellum) from 3 fetuses (two of 14 and one of 15 post-conception weeks, all female). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) with ethical approval. snRNA-seq libraries were prepared from ∼10,000 nuclei from each sample using Chromium Single Cell 3ʹ (v3) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 865 million (median = 1.01 billion) read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Biological Psychiatry 2022, https://doi.org/10.1016/j.biopsych.2022.06.033.

  Dataset EGAD00001009303

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774